Lucifer's DNA - The Movie

Originally posted by swanne
reply to post by UncleMikey

 

Hi, just posting so I can come back to this thread later and read it more thoroughly. It seems you've put quite alot of thoughts into this, and may I meanwhile present to you the works of Pjotr Garjajev and his DNA language: digitaljournal.com... Do remember though that his findings are on the limit of science and many think he's a hoax (as for me I need to have more evidence before making such judgement).

Awesome!

From your link...

The language of DNA is considered a high-level form of communication, in the company of human language, artificial languages (genetic codes, Morse codes and the computer). The founder of Microsoft, Bill Gates, stated that "DNA is like a software program, only much more complex than anything we've ever devised."

Yet in their actual size—which is only two millionths of a millimeter thick—a teaspoon of DNA, according to molecular biologist Michael Denton, could contain all the information needed to build the proteins for all the species of organisms that have ever lived on the earth, and "there would still be enough room left for all the information in every book ever written."

The coding of DNAs contain several key elements in order to communicate in its own language; at least, in order for a change to occur.

High-level DNA communication is grouped with human languages and artificial languages --- such as computer languages, Morse code, and genetic codes.

* The DNA must have an alphabet or coding system
* The DNA must have correct spelling
* The DNA must have a proper arrangement of words
* The DNA must have meaning (semantics)
* The DNA must have an intended purpose

reply to post by UncleMikey


Great stuff UncleMikey keep it coming! My only complaint is that you don't update this thread quick enough

Ps
Regarding something we discussed previously; you know how you sad you didn't want to embark on the grueling task of filming a vid editing etc etc because you don't get paid for it, and you still have a 9-5 and don't wan't to put in lots of work if no one will be interested? Well I wouldn't mind helping or taking on the project of putting the vid you want together, if you want. If not that is ok too. After all you know what they say two heads are better than one, and the more the merrier

Anyways I look forward to the next update of this thread.


Enjoy This Excerpt

2 Samuel 6:6-7 KJV

6 And when they came to Nachon's threshingfloor, Uzzah put forth his hand to the ark of God, and took hold of it; for the oxen shook it.

7 And the anger of the Lord was kindled against Uzzah; and God smote him there for his error; and there he died by the ark of God.

reply to post by HumanitiesLastHope


Aww thanks HumanitiesLastHope. I actually have some more posts written up, I just need to cut and paste them here. I'll get one posted later today.

That's nice of you to offer to help.

I never saw those verses before! That shows me that the Ark is very, very important, and humans shouldn't be messing with it.

Very interesting indeed.

We are continuing from where we left off last time when were discussing this movie scene...



Fast forward to Revelation (the ‘end’ of The Bible).

Virgo in Revelation would be the opposite of what is described in Gen-Isis. Instead of man ‘falling’ into a lower dimensional state, we are ‘upgraded’ into a higher one!

We are 're-birthed' out of Virgo... and become like Jesus.

Occultists sometimes call it "passing between the two pillars (Jachin and Boaz) of the High Priestess". Remember though… just because a High Priestess calls herself a ‘virgin’ doesn’t make it so…

youtu.be...



Want to go to the ‘underworld’ instead? Follow her!!!

youtu.be...



Nice trick Lucifer!!!

Now look what you’ve done. Someone has to be re-grafted onto the Tree of Good and Evil aaaaall over again... or that's what they hope anyhow. Doh.

They look like they are standing in Fire and Brimstone...



Continuing on…

The Four Living Creatures (A, C, G and T) mentioned in Revelation are joined with other 'bases' and we are grafted back onto the Tree of Life… Jesus!

Note that the 'Dragon' (that old serpent of Phosphorus DNA strands) is there to try and 'swallow the child' (i.e. he tries to re-graft you and I into 'his' world again), but is unsuccessful.



Revelation 12:4
"And his tail swept away a third of the stars of heaven and threw them to the earth. And the dragon stood before the woman who was about to give birth, so that when she gave birth he might devour her child"

Notice also that he is casting stars (birth chemicals) to Earth… to a mothers ovum… to ‘tempt’ us back into the womb again.

Thank goodness we aren’t going to fall for it!

We will now upgraded and become like the Sun of God and rule with an Iron Core (Suns have iron cores).

Ok... so in the End of Days... the Two Witnesses (along with A, C, G, T) will 'speak' and give their testimony.

Adenine
Cytosine
Guanine
Thymine

They will 'speak'...

AUGACGGAGCUUCGGAGCUAGAUGACGGAGCUUCGGAGCUAGAUGACGGAGCUUCGGAGCUAGAUGACGGAGCUUCGGAGCUAGAUGACGGAGCUUCGGAGCUAGAUGACGGAGCUUCGGAGCUAG

Get it?

They are incapable of lying. They are the perfect witnesses!

What do you think The Two Witnesses have to say about Monsanto's products?

LAMENESSSUFFERINGPOISONEVILCORRUPTION

Wait... those don't look like normal DNA sequences do they?

God will hear that testimony and discover that some THIEF has entered the Most Holy Place (DNA) and corrupted it.

God will be very upset with this news... and will 'sterilize' this planet and everything in it by fire.

So… back to the Tracing Boards.

The Bible has a prayer…

Matthew 6:10
"Thy kingdom come. Thy will be done in earth, as it is in heaven"

As Above… So Below? Hmmmm…

What if we were to take the twelve signs of the Zodiac and assign them a DNA Base? Could this be what the elites are trying to re-create?



A so called 'Supreme Being' with DNA that joins Heaven and Earth perhaps?





Such tampering of The Most Holy Place will no doubt make God angry. You might even call a GMO being like that The AntiChrist.

Yikes.

Now then... let's take another Masonic Tracing Board and compare it to a Nucleotide.

Here is a graphic to get us started...



...and here is the Royal Arch...





Seems to match up well. I wonder why?

Now that your eyes are adjusting to the hidden codes... let's test them on this painting to see how well your X-Ray vision is functioning...



There is a couple standing on the 'Royal Arch'. They may represent two signs of the 12 sign Zodiac... leaving ten. Is that the ten below?

Nine women or 'signs' are 'pair bonding' with each other. There is one more sign on the left playing the Lyre. That's a total of twelve signs. But wait... there is one more person on the right.

That's the Magickian!





He is the one that will create the Supreme Being.

What about the man in the cave over to the left?

Revelation 9:2
"And he opened the bottomless pit; and there arose a smoke out of the pit, as the smoke of a great furnace; and the sun and the air were darkened by reason of the smoke of the pit"

Sounds like he may be trapped in the underworld, awaiting resurrection by a professional Alchemist.

Look at the bottom of the painting. See the crack in the Earth with water all around? Note how it matches with the Tracing Board and the casket... waiting to 'rise from the checkerboard sea'.



Kinda reminds me of Baphomet.

To be continued.

All righty then...

Now that you know that the Cross represents the Chromosome shaped like an 'X'...

...and you know a little about DNA...

...and a little bit about a Bio-Engineered AntiChrist Supreme Being...

...and a woman called 'The Harlot' that is the opposite of the *real* Madonna Virgin Mary...

...and an 'abomination' sitting in the Most Holy Place...

you can now decode these images!

reply to post by UncleMikey


K I'm half way thru the vid and have to resume later.
Just wanted to say you're a trip Uncle Daddy Mikey.
SnF

reply to post by Blue Shift


Two posts into the thread and I've gone from bio-chemical metamorphosis of mutations manifesting
an interesting and theological hallucination that somehow blends with reality on a cyclical time frame.

To an outright hysterical crack.

I suppose this is the equivalent of somebody pasting a lot of pictures and newspaper clippings and Bible pages on their wall and connecting them with bits of yarn. Something the police would later find.

Blue shift got his funny pants on.

reply to post by UncleMikey


Just spent the last couple of hours in this thread and am intrigued. There have been crop circles that have appeared to be DNA and one in late 2012 that was thought to be a change to DNA. I know it isn't with the spirit of your project but they kept popping into my mind. As if warnings. Your providing a way to identify the enemy so keep on going with this. I love how genetically modified foods and people are being compared to the arc of the covenant.

With regard to you working backwards and being biased as some said herein - I would comment that in this case it's appropriate. You clearly have a theory and are finding things that fit the theory about humanities oldest and most complex advasary. Its not like you have a control group. Its a complicated subject and I applaud your work. Looking forward to more.

reply to post by Ender58


I hope that you notice that the phrase has no meaning since the comparison is faulty. Comparing life to a Boeing 747 would be the start of the error they do not share any characteristics.

The fact remains that the "tornado" did manage to build a Boeing 747 indirectly by creating life in the first place. This beautiful emergent system order, the coming together of the "perfect storm" is what makes me a pantheist.

Originally posted by Dianec
reply to post by UncleMikey

 

There have been crop circles that have appeared to be DNA and one in late 2012 that was thought to be a change to DNA.

A beast rises out of the sea... walks on water... time stands still... Three Magdalene...

youtu.be...



Daniel 7:25
"And he shall speak great words against the most High, and shall wear out the saints of the most High, and think to change times and laws: and they shall be given into his hand until a time and times and the dividing of time"

From Wikipedia...

"The distinctive pattern of Orion has been recognized in numerous cultures around the world, and many myths have been associated with it"

"The same three stars are known in Spain and most of Latin America as "Las tres Marías" (Spanish for "The Three Marys")"

"the Nephilim may have been Orion's descendants"

en.wikipedia.org...

I'm glad you are recruiting, but it won't help. It is time to go now. I do hope you can carry all of this with you. Can't sit still and enjoy the view without some graven image of synchronicity barreling through you.
Such a burden to keep that monster fed
In your head.
That beast has fled
Lost and without a host
But still you seem to boast.

Where is he, them, the lumen, the structure, the control, the alignment, the righteous sovereignty?
Never was
and never will
Kill Bill
Dressed in Imperial Yellow
So go *bleep* yourselves in the corner with a dunce cap, that is all.

reply to post by UncleMikey


Haven't seen the video, but looking at the video preview thumbnail, looks like it has something to do with carbon having 6 electrons, protons and neutrons.... and some connection to 666.

Well, the actual Biblical verse says six hundred and sixty six...i.e - the number after 665...and not the numerical combination of 6, 6 and 6.

reply to post by UncleMikey


It will take me some time to get through all your data but one thing comes to mind. I often wondered about the story of Babel and thought that it could also represent the tampering of our DNA. I haven't really researched into it but it seemed to be plausible.

Not that I do not believe there was an actual tower but I also believe that it is a metaphor of how our DNA was intercepted and altered by the fallen 'geneticists'.

Wrote this yesterday for a friend:

The ‘Kingdom of God’ Summarized

What is The Kingdom of God mentioned in Scripture?

First let’s establish who’s “in the know”:

Mark 4:11
“And he (Jesus) said unto them, Unto you (the Twelve Disciples) it is given to know the mystery of the kingdom of God: but unto them that are without (the rest of humanity), all these things are done in parables”

The ‘Mystery' of the Kingdom of God is revealed to Jesus and his Twelve Disciples, but not the rest of humanity.

For us, the ‘Mystery’ is done in ‘parables’ or rather it is ‘encrypted’ throughout the Bible. Why?

Mark 4:12
“That seeing they may see, and not perceive; and hearing they may hear, and not understand; lest at any time they should be converted, and their sins should be forgiven them”

Profound! Basically what's being said here is that one must ‘earn’ the right to know, by studying scripture faithfully, continually, and not simply be handed knowledge on a silver platter like a spoiled child that doesn’t deserve it.

It’s a strict way of weeding out the ‘unfaithful’ and to prevent evildoers from using the knowledge of the Kingdom of God for their own selfish agendas, or even worse, to take control of it.

So, what exactly is the Kingdom of God?

Luke 17:21
“Neither shall they say, Lo here! or, lo there! for, behold, the kingdom of God is within you”

That is one of the biggest clues. The Kingdom of God is ‘within us’. This is where one must look in order to know what it is.

Some may say that the term ‘within’ means ‘within in our imagination’. This is not true, for ‘imagination’ is generally something to be cast down. Man’s ‘imagination’ is often filled with wickedness.

Jeremiah 11:8
“Yet they obeyed not, nor inclined their ear, but walked every one in the imagination of their evil heart: therefore I will bring upon them all the words of this covenant, which I commanded them to do; but they did them not”

So could it be something tangible, like our physiology? Again, we are faced with the same problem, as our ‘flesh’ is corrupt as well as our imagination.

Galatians 6:8
“For he that soweth to his flesh shall of the flesh reap corruption; but he that soweth to the Spirit shall of the Spirit reap life everlasting”

1 Corinthians 5:5
"To deliver such an one unto Satan for the destruction of the flesh, that the spirit may be saved in the day of the Lord Jesus"

Wait a minute! The Spirit is saved? Life everlasting? Could that be Kingdom of God that is within us?

Let’s look at the word ‘Spirit’ to see what we can find.

Revelation 5:6
“And I beheld, and, lo, in the midst of the throne and of the four beasts, and in the midst of the elders, stood a Lamb as it had been slain, having seven horns and seven eyes, which are the seven Spirits of God sent forth into all the earth”

Seven ‘eyes’ and seven ‘horns’ are the spirit? What the heck?

Encircled by ‘Four Beasts’? What's going on here?

Sounds like DNA!



DNA is the ‘Quaternary Computer Code’ that allows us to interact with this 3D world… or ‘Matrix’.

en.wikipedia.org...

Numbers 18:15
“Every thing that openeth the matrix in all flesh, which they bring unto the LORD, whether it be of men or beasts, shall be thine: nevertheless the firstborn of man shalt thou surely redeem, and the firstling of unclean beasts shalt thou redeem”

We are literally born into The Matrix. Gotta love that KJV terminology… Lol!

DNA is made of something call ‘Nitrogenous Bases’, or rather A, C, G, T.

en.wikipedia.org...

What is Nitrogen? It's Air or Breath! Spirit & Breath are often considered one and the same in scripture:

Job 32:8
“But there is a spirit within people, the breath of the Almighty within them, that makes them intelligent”

Guess what element Nitrogen is?

Element Seven... a VERY special number indeed!



There are ‘Four Winds’ that give life…

Ezekiel 37:9
“Then said he unto me, Prophesy unto the wind, prophesy, son of man, and say to the wind, Thus saith the Lord GOD; Come from the four winds, O breath, and breathe upon these slain, that they may live”

Again… Winds = Breath = Nitrogen = A, C, G, T.

What does A, C, G, T or ‘Four Beasts’ encircle?

The Throne.

And in the world of DNA, the center ‘Throne’ would be the center Hydrogen Bonds:



When we finally put it all together we can see a clear picture emerging:



So it would seem that… when we pass away… our ‘Spirit’ or A, C, G, T Quaternary Computer Code is retained and preserved through Christ Jesus!

Why always the ‘Left Eye’ with these Masons?









Are they playing the fool?

1 Samuel 11:2
"And Nahash the Ammonite answered them, On this condition will I make a covenant with you, that I may thrust out all your right eyes, and lay it for a reproach upon all Israel"

Zechariah 11:17
"Woe to the idol shepherd that leaveth the flock! the sword shall be upon his arm, and upon his right eye: his arm shall be clean dried up, and his right eye shall be utterly darkened"

They are seeing the Nucleotide, and not the entire DNA…



What would happen if they looked through BOTH eyes?





Matthew 21:42
"Jesus saith unto them, Did ye never read in the scriptures, The stone which the builders rejected, the same is become the head of the corner: this is the Lord's doing, and it is marvellous in our eyes?"

Ah… now we see why The Lord did that.

You can’t have Twelve Strand DNA without the Chief Cornerstone!



What about Three Strands or Three Pillars?

One strand hidden 'below' is there?





It's wake up time!

reply to post by UncleMikey


If you are going to put words in a video you need to leave them up long enough to be read...and I am an above average reader (not quite a speed reader). So it was just blippity bloop on to the next clip. But then maybe that was your point pretty pictures without factual information?

reply to post by UncleMikey

There are ‘Four Winds’ that give life… Ezekiel 37:9 “Then said he unto me, Prophesy unto the wind, prophesy, son of man, and say to the wind, Thus saith the Lord GOD; Come from the four winds, O breath, and breathe upon these slain, that they may live”

And you certainly are a breath of fresh air yourself

Thank you for taking the time and making the effort to deliver the truths that you have.

For those with the eyes to see and the ears to listen in deed.

Your ambition is awesome.

Am actually doing my own little research using yours. I find , personally, that letters hold importance. Each with their own association. I pin this down to the frequency of the letter, for example the noise that is made when saying the letter.

edit: you mention the three p's, or something to do with three Marys. Anyway this link Results from google

The first two wiki links highlight these two things with the acronym PPP. Both these things are global and are of great importance.