If evolution is not proven, why do we share 96% of our genetics with monkey?

I really wish I joined in on this discussion a little earlier, I always come late to the party and by then everyone is already fired up to crucify me

Originally posted by Southern Guardian
How is it that we relate so closely genetically with monkeys? I mean if there is an alternative to evolution, which would mean that we 'adapted' totally seperately and individually, how do we relate so closely?

Most Evolutionists use this claim to somehow prove that Humans and Chimps evolved from a common ancestor, yet it's mostly show. The average person would fall for it, but with a little research, these claims are squashed.

Let's begin with a little truth. First of all, how big is a human genome? This site here, under the question "How big is the human genome?", paragraph 2 states -

Storing all this information is a great challenge to computer experts known as bioinformatics specialists. One million bases (called a megabase and abbreviated Mb) of DNA sequence data is roughly equivalent to 1 megabyte of computer data storage space. Since the human genome is 3 billion base pairs long, 3 gigabytes of computer data storage space are needed to store the entire genome. This includes nucleotide sequence data only and does not include data annotations and other information that can be associated with sequence data.

Great, 3 billion base pairs. That's a lot.

Secondly, when this study was first done, they stated the similarities are 99.8%, and over the years, as we learned more, it slowly got reduced, to 98%, then to 97%, then to 95%.. however, since I'm really tired, we'll go with the OP's article and assume a similarity of 96%.

Seems like a very strong case for Evolution, doesn't it? Well.. let's examine that 4%. A simple calculation will tell you that 4% of 3 billion base pairs is..

120,000,000 - That's one hundred and twenty million genetic differences between us and chimpanzees. That's quite a lot, considering normal humans only have about a .1% difference between any other human - which is still a lot; that's 3 million differences between you and anyone else you meet on the street.

Now, Evolutionists will say, "but they still have 2.88 billion genetic similarities!" - true, they do, but let's look into a statement made by Dr. Barney Maddox, the leading genome researcher on the DNA project "Human Genome Project" -

Now the genetic difference between human and his nearest relative, the chimpanzee, is at least 1.6%. That doesn't sound like much, but calculated out, that is a gap of at least 48,000,000 nucleotides, and a change of only 3 nucleotides is fatal to an animal; there is no possibility of change.

Emphasis on that last part.

This isn't sort of thing isn't explained very well by creationists/intelligent designers. I'd love to hear from anybody. If we really evolved totally seperately all these many many years, we would not be so closely related.

It doesn't necessarily need to be explained, because it isn't much of an issue at all, as we just addressed. However, if I must give an answer, I would presume that common design between us humans and chimpanzees simply suggest a common designer. That's the most simplistic answer I can give right now, as I'm really tired and should get to bed.

Goodnight, fine ATS members! Deny ignorance on your journey to truth!

God bless.

Originally posted by Lionhearte
Now, Evolutionists will say, "but they still have 2.88 billion genetic similarities!" - true, they do, but let's look into a statement made by Dr. Barney Maddox, the leading genome researcher on the DNA project "Human Genome Project" -

Now the genetic difference between human and his nearest relative, the chimpanzee, is at least 1.6%. That doesn't sound like much, but calculated out, that is a gap of at least 48,000,000 nucleotides, and a change of only 3 nucleotides is fatal to an animal; there is no possibility of change.

Emphasis on that last part.

That's funny. This Barney Maddox character appears to be a young earth creationist, and a urologist, not "the leading genome researcher on the DNA project Human Genome Project". How about that? Why do you evolution deniers always lie? Isn't it against your religion? What would Jesus say? Why aren't you even trying to use your brains? I mean, if change of just 3 nucleotides would be fatal, then wouldn't this imply that all humans (as other species) were genetically almost absolutely identical, give or take just 2 nt difference. You know, even 1 nt change can be fatal (e.g. a nucleotide insertion into a critical gene). Consequently, such individuals will never reproduce (since they die before birth), and thus, such critical changes are meaningless, i.e. natural selection keeps them out from the gene pool.

p.s. I think according to be Bible, you should face the death penalty.

Psalms 31:18, "Let the lying lips be put to silence;"

I'm going to keep this short because I posted this simple fact a few times recently.

NO we are not 96% similar.

The protein coding sequences are 96% similar. This makes up less than 2% of the entire genome.

96% similiar in but 2% of the entire genome.

Darwinist ignore the so called junk DNA as left over evolutionary rubbish. This is turning out to be false. More and more insight into "junk" dna is ocuuring almost daily.

Comparng the entire genome we are around 70% similar at this point in time, well within expectations simply because of similarity in body plan

How can we be 96% similar when the chimp genome is around 10 to 12 % larger?

Want to talk differences? Unexplained mysteries of evolution? look at the Y chromosome, The X has few surprises as well. You'll find out we are quite different.

Darwinists had definately jumped the gun on this one. This myth will not fade easily.

How come the "experts" with thier evolution is a 100% proven mantra not know this? I might have to ge off my A and do a thread.

Evolution happens by some yet unknown causes.

Originally posted by squiz
I'm going to keep this short because I posted this simple fact a few times recently.

NO we are not 96% similar.

The protein coding sequences are 96% similar. This makes up less than 2% of the entire genome.

96% similiar in but 2% of the entire genome.

Also rRNA and tRNA genes are virtually identical in humans and chimps, just like the entire mitochondrial genomes (not just protein-coding bits).

Originally posted by squiz
Darwinist ignore the so called junk DNA as left over evolutionary rubbish. This is turning out to be false. More and more insight into "junk" dna is ocuuring almost daily.

Is a Darwinist a person who thinks evolution is exactly as described by Charles Darwin? There are very few such people around. Anyway, how can junk DNA be ignored and studied (insight occurring almost daily) at the same time? There's still a lot we don't know about ncRNA. Nonetheless, the vast majority of human genome consists of repetitive DNA, which is totally useless (evidence for this being that these regions vary significantly in length between individuals). Another 10% of the human genome consists of inactive (not expressed) degraded retro-viral sequences, which again, are more or less useless.

Originally posted by squiz
How can we be 96% similar when the chimp genome is around 10 to 12 % larger?

A) ATTTCGATTTCGATTTCGATTTCGATTTCGATTTCGATTTCGATTTCG
B) ATTTCGATTTCG

How similar would you say the above two sequences are? The size difference of human & chimp genomes is mainly due to such repetitive intergenic sequences.

reply to post by squiz

Who we are is in our junk DNA. How intelligent we are is within our junk DNA. Our immunity and our response to stress and famine is in our junk DNA. How similar are the monkeys junk DNA and ours. Although I believe that humans and monkeys evolved from the same Hominoid creature a very very long time ago we are not even close to the same anymore. We are related to all living things after all so all living things our our kin including trees and fungi.. I am not a supporter of the theory of evolution as the basis of our creation here on earth. Our coding is of extraterrestrial design. I'm sure that part of the advanced life here is alien in origin but it happened long ago.

If the Theory of Evolution wasn't so messed up with limitations I might believe in it. As it stands it has not enough possibilities of things that we have yet to learn being left blank or undiscovered. If the theory said "well this is what we think happened but we really have no clue of what the hell actually happened" I would possibly believe it. Because of my intellect I cannot agree to screwed up logic. If it makes you happy, I find the creation theory a little amusing. I kind of like amusing better than screwed up logic though.

Originally posted by rhinoceros
Also rRNA and tRNA genes are virtually identical in humans and chimps, just like the entire mitochondrial genomes (not just protein-coding bits).

The 96% figure is based on the coding sequences as I said. We have about 70% similarity so yes other parts are similar. How can they not with that figure? What's your point? Infact some are exactly the same and highly conserved.

Is a Darwinist a person who thinks evolution is exactly as described by Charles Darwin? There are very few such people around. Anyway, how can junk DNA be ignored and studied (insight occurring almost daily) at the same time? There's still a lot we don't know about ncRNA. Nonetheless, the vast majority of human genome consists of repetitive DNA, which is totally useless (evidence for this being that these regions vary significantly in length between individuals). Another 10% of the human genome consists of inactive (not expressed) degraded retro-viral sequences, which again, are more or less useless.

Perhaps I should say neodarwinism or the modern synthesis, I refer to the mechanism.
Junk DNA was ignored, Since we did not know it's function. More is being discovered all the time and that argument is slowly shrinking. Can you be so sure that the supposedly inactive regions have no purpose? Isn't that kind of the same assumption once again?

A) ATTTCGATTTCGATTTCGATTTCGATTTCGATTTCGATTTCGATTTCG
B) ATTTCGATTTCG

Very different. It's not the pieces but the arrangement that is important.

How do we reconcile with this?

www.genetics.org...

100 million years for two mutations, It was meant to refute IDer Michael Behe. It only raises more problems don't you think? It's was based on standard Darwinian population genetics.

I'm not against evolution, I just don't believe the proposed mechanism is sufficient. That is what the evidence says. if there was/is a designer why would it try to reinvent the wheel each time? Engineers will use what works and adapt it. Common decent or is it common design?

sorry, double post.

Originally posted by squiz
How do we reconcile with this?

www.genetics.org...

100 million years for two mutations, It was meant to refute IDer Michael Behe. It only raises more problems don't you think? It's was based on standard Darwinian population genetics.

I'm not against evolution, I just don't believe the proposed mechanism is sufficient. That is what the evidence says. if there was/is a designer why would it try to reinvent the wheel each time? Engineers will use what works and adapt it. Common decent or is it common design?

edit on 7-6-2012 by squiz because: (no reason given)

How does that abstract show evidence of ID? It doesn't. It also said a FEW million years. 100 million years in very small populations, which homo sapiens are certainly not. Besides, they are talking about how long a CERTAIN mutation that has to do with tumor suppression would take, not all mutations in general, and doesn't take into account drastic changes in environment. This seems typical of ID advocates, misunderstanding scientific studies, and once again attacking the strawman "Darwinism" instead of modern synthesis. Talk about forcing the evidence to fit what you want it to.

Let's begin with a little truth. First of all, how big is a human genome? This site here, under the question "How big is the human genome?", paragraph 2 states -

Not a single thing you said, proves your point.

Darwinism - a term from the 1800s referring to Darwin's version of evolution, which eventually became the theory of evolution as more evidence was discovered. Darwinism DOES NOT EXIST anymore. It is a dishonest term.

Darwinist - another term from the 1800s describing one who followed Darwin's original theory. Again, not applicable today.

Evolutionist - a term made up by creationists, to somehow try to turn evolution into a belief system. Completely false, there's no such thing as an evolutionist. There are biologists that study the theory.

Stop using these deceptive, insulting terms please. I don't refer to creationists or ID advocates as lunatics, so please show the same respect if you wish to discuss science.

Never said it was evidence of ID. It's an argument against an ID proponent.

It's a few million years for the fruit fly.

Nice reading comprehension though.

Originally posted by Barcs
Stop using these deceptive, insulting terms please.

Insulting? really. A bit like how any other view is falsey represented as creationism?

Perhaps if you do the same I will too.

Originally posted by squiz

Originally posted by rhinoceros
Also rRNA and tRNA genes are virtually identical in humans and chimps, just like the entire mitochondrial genomes (not just protein-coding bits).

The 96% figure is based on the coding sequences as I said. We have about 70% similarity so yes other parts are similar. How can they not with that figure? What's your point? Infact some are exactly the same and highly conserved.

We are almost exclusively the result of our protein-coding genes, and the degree to which they're expressed. You think that 70% figure for total genomes implies sequence similarity? I'm almost certain it's just a hybridization percentage. Bacterial genomes that share > 95% total sequence show ~70% DNA-DNA hybridization values. Things like order of the sequences affect this, and since stuff tends to recombine, genes are shuffled around the genome.

Originally posted by squiz
Can you be so sure that the supposedly inactive regions have no purpose? Isn't that kind of the same assumption once again?

No. It's backed up by studies in which such regions were deliberately removed from genomes.

A) ATTTCGATTTCGATTTCGATTTCGATTTCGATTTCGATTTCGATTTCG
B) ATTTCGATTTCG

Very different. It's not the pieces but the arrangement that is important.

In case you didn't notice, it's just ATTTCG repeating over and over. The size difference in human and chimp genomes is mostly about this. E.g. in some locus in humans we might have ATTTCG repeated 1000 times, then in chimp genome 1200 times. You can still say, that on sequence level, such regions are 100% identical.

To compare the two genomes, the first thing we must do is to line up the parts of each genome that are similar. When we do this alignment, we discover that only 2400 million of the human genome’s 3164.7 million ’letters’ align with the chimpanzee genome - that is, 76% of the human genome. Some scientists have argued that the 24% of the human genome that does not line up with the chimpanzee genome is useless ”junk DNA”. However, it now seems that this DNA could contain over 600 protein-coding genes, and also code for functional RNA molecules.

Looking closely at the chimpanzee-like 76% of the human genome, we find that to make an exact alignment, we often have to introduce artificial gaps in either the human or the chimp genome. These gaps give another 3% difference. So now we have a 73% similarity between the two genomes.

In the neatly aligned sequences we now find another form of difference, where a single ’letter’ is different between the human and chimp genomes. These provide another 1.23% difference between the two genomes. Thus, the percentage difference is now at around 72%.

We also find places where two pieces of human genome align with only one piece of chimp genome, or two pieces of chimp genome align with one piece of human genome. This ”copy number variation” causes another 2.7% difference between the two species. Therefore the total similarity of the genomes could be below 70%.

This figure does not take include differences in the organization of the two genomes. At present we cannot fully assess the difference in structure of the two genomes, because the human genome was used as a template (or ”scaffold”) when the chimpanzee draft genome was assembled.

Our new knowledge of the human and chimpanzee genomes contradicts the idea that humans are 98% chimpanzee, and undermines the implications that have been drawn from this figure. It suggests that there is a huge amount exciting research still to be done in human genetics.

www.refdag.nl...

Hmm... 6 million years, when generous Darwinian population genetics says 100 million years for Two mutations. Something isn't right I think.

As well as the chimp DNA draft being based on humans from the very get go.

Are we 96% the same? True or false?

Although their function has not yet been clearly elucidated, interstitial telomeric sequences (ITSs) have been cytogenetically associated with chromosomal reorganizations, fragile sites, and recombination hotspots. In this paper, we show that ITSs are not located at the exact evolutionary breakpoints of the inversions between human and chimpanzee and between human and rhesus macaque chromosomes. We proved that ITSs are not signs of repair in the breakpoints of the chromosome reorganizations analyzed. We found ITSs in the region (0.7-2.7 Mb) flanking one of the two breakpoints in all the inversions assessed. The presence of ITSs in those locations is not by chance. They are short (up to 7.83 repeats) and almost perfect (82.5-97.1% matches). The ITSs are conserved in the species compared, showing that they were present before the reorganizations occurred

www.ncbi.nlm.nih.gov...

The difference just gets wider and wider.

Originally posted by squiz
The difference just gets wider and wider.

Apply the same criteria two humans and all of a sudden we're not nearly identical with each other. There's a reason why protein-coding genes show highly negative mutation pressure in comparison to intergenic spacers. It's because those spacers don't do anything biologically significant, and are thus free to change.

Originally posted by rhinoceros
In case you didn't notice, it's just ATTTCG repeating over and over. The size difference in human and chimp genomes is mostly about this. E.g. in some locus in humans we might have ATTTCG repeated 1000 times, then in chimp genome 1200 times. You can still say, that on sequence level, such regions are 100% identical.

I don't think so. Neither does the science.

How, precisely, are miles and miles of TTAGGG of significance? From the standpoint of chromosome architecture, the repetitive elements en masse have the propensity to form complicated topologies such as quadruplex DNA. These sequences or, rather, topographies are also bound by a host of chromatin proteins and particular RNAs to generate a unique "suborganelle" -- for the lack of better term -- at each end. As a matter of fact, the chromatin organization of telomeres can silence genes and has been linked to epigenetic modes of inheritance in yeast and fruit flies. Furthermore, different classes of transcripts emanate from telomeres and their flanking repetitive DNA regions, which are involved in various and sundry cellular and developmental operations.

reply to post by squiz

I was talking about intergenic regions, not telomere regions. Learn the difference.

Originally posted by TheCelestialHuman
reply to post by Southern Guardian

 

I think it's about time humans accept their lowly origins and stop being so conceited, believing that the entire universe was created with them in mind. Most people have no idea how unimportant they are.

I can tell you my kids are pretty important to me and a damn sight more important than a rock or insect

Originally posted by rhinoceros
Apply the same criteria two humans and all of a sudden we're not nearly identical with each other.

Are you saying the ITS diferences vary just as much between individuals as they do between us and chimps?

Originally posted by rhinoceros
reply to post by squiz

 

I was talking about intergenic regions, not telomere regions. Learn the difference.

Furthermore, different classes of transcripts emanate from telomeres and their flanking repetitive DNA regions,

Are we 96% similar true or false?