heavy water

i was reading this thread www.abovetopsecret.com...
and came across this line
"He is saying they are going to find this water with less heaviness. Scientists will discover this new purer water will retard the aging process by about 80 times. People could live 300 or 400 years. The technology to extract this new water in 2007 will be available."
I decide to do some research on heavy water and found this site www.sumeria.net...
it is all very new to me and i am planning on doing a lot more research. I just wanted to know what you guys think and if you have any other information please post

All heavy water is is H30 instead of H20...

This looks like a good document:

www.cns-snc.ca...

Seems like a must have for the ever growing need for energy. Great pdf valhall, i forgot most about chemical reaction diagrams and stuff like that, it boosts it up a bit.

Now H2 is much touted as the fuel for the new century. Burned in fuel cells, it is free
from the polluting effects of VOCs and NOx. If it were produced electrolytically from
electricity produced by nuclear or other low-CO2-releasing sustainable technologies, it
could be the ultimate transportation fuel source to redress greenhouse gas emissions
associated with traditional fuels or hydrogen produced by SMR technology. The
combination of nuclear electric generation�water electrolysis�and D2O production by
CECE is an alluring possibility.

Interesting...

Now THAT is cool.

The world has a lot of stuff that the average guy will never be able to see. but if that guy had 300 years to blow... well that should allow for a lot of sightseeing! and just think! by the time that same guy hits 200, they could be doing holidays in space!

ponce de leon,
and zie fountain of youth?

Originally posted by Daystar

Now THAT is cool.

The world has a lot of stuff that the average guy will never be able to see. but if that guy had 300 years to blow... well that should allow for a lot of sightseeing! and just think! by the time that same guy hits 200, they could be doing holidays in space!

Actually a 300 year lifespan is 100% possible, if it were not for telomeres.

For those who haven't spent the last few years running DNA gels, telomeres are the DNA at the very tip of each chromosome. This DNA does not "say" anything in the genetic code because it contains no "start" codons or promoters; it just repeats "TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG . . ." and so on for about 20,000 "letters" (base pairs) in a young human being. This telomeric DNA is essential for all eukaryotic (chromosome-containing, i.e. everything above bacteria) cells. It forms a protective cap at the tip of each chromosome that keeps chromosomes from fusing with other chromosomes at the tips. Without telomeres, chromosomes can't maintain their individuality. Fused chromosomes also have trouble dividing and separating into daughter cells. Like a society without property rights, a cell without telomeres quickly breaks down and quits functioning properly.

Most of your body cells ("somatic cells", in correct mad scientist jargon) are steadily losing their telomeres. Each time they divide, your cells don't replicate the last 50-150 base pairs of the telomere. So your telomeres keep shortening, from 20,000 DNA base pairs or so at birth to below 5,000 base pairs. At some critical point your cells will 'senesce'. Senescent cells can continue to live for a long time, but they can't divide again. Eventually the random terrorism of entropy kills them, whether from oxidative damage or DNA repair error. When you run low on functional cells in essential systems like artery endothelium, you die.

freedom.orlingrabbe.com...

dude, you a say a lot of big shiny words that make people look and nod their heads. telemeres somatic chromosome
and especially this one

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

wtf???


jk. but this all sounds interesting, i belive it to be possible. does this mean i won't see my first wrinkles til i'm 180? let's hope so! 100 years of sexual primetime? dude. dude!!!

Basically telomeres are the part of your DNA that tell you when to die.

They are genetic limiters on DNA/RNA replication, that after a preset amount of time stops allowing replication... Then when you run out of functional cells, you die.

Cheery thought isnt it?

100 years of sexual primetime? Dude, you'd stroke out in no time!

Dude, you'd stroke out in no time!

cold cold cold

hey, at least i'd live to see the first space porno, but let's take this down a different road.

most people have bad enough lives right now, would they really want to live that long. the only people that'd be able to get this technology would be mad rich, or mad lucky for winning the jackpot, just what we need, a 300 year old lotto winner, we never heard of these ppl before that. it does have its... evil, uses i dare say.

most people have bad enough lives right now, would they really want to live that long. the only people that'd be able to get this technology would be mad rich, or mad lucky for winning the jackpot, just what we need, a 300 year old lotto winner, we never heard of these ppl before that. it does have its... evil, uses i dare say. Posted by Phoenix Cross

And that is the crux of the problem.

What do you do when the majority of the population is way old, and retired, not contributing to the system anymore, and taking up resources?

I dont want to sound like I am anti retired people or anything, but in this scenario, we would suddenly have a logjam of a large number of retired people who are not contributing and who dont die that have to be taken care of in one way or another.

If the birthrate continued at the normal rate, with no deathrate to clear the way, things would get crowded really quick.

i can see it now, the year is 2100, and the rebel group Sin has launched a terror attack, on 5th Jerusalem, by now it WILL be 5th jerusalem, and killed 23 million people with a single block of c-4.

actually, if i remember, there was some scifi movie, where the capitol for the galaxy was a giant city planet. could be somethin like that, was that # star wars?

Not sure what movie you are referring to, but if you want a nightmare overcrowding scenario, go see Soylent Green with Charlton Heston... pretty freaky.

What can we do about it?



[Edited on 27-6-2003 by MKULTRA]

Hey, my old post. Glad to see it back in action, water that helps, hopefully I can retain my looks.

Hmm if i rember right heavy water is used as a coolant in nuclear reactors.

Sounds kool although tampering with stuff like that should happen in my oppinion. Lots of these lil things that have ben popping up were all stories or scifi... They starting to turn into reality.

I have a feeling ppl have know many remedies for long life and cures although these people respected nature, so these theories were kept to themselves. In our current corupt world this will only be used to make $$$, im dunno bout uz but i dun want another Hitler alive even if he would be 200 yrz old

Hooooodoggies dragonrider! Them words are spiffier than a store bought pair of shoe laces. I never would have researched that, but am real glad that you posted it. It really gives one something to think about.

DEN OF THE DAMNED

i dont really care about the money i just want to figure it out so i can live to 200

Heavy water is actually D2O (H2O).
D is the Deuterium isotope of Hydrogen which has 1 neutron, which normal "light water(H2O)" doesn't have.
H3O+ is actually the Hydronium ion which is an acid.
Deutrium is twice as heavy as normal Hydrogen
T2O is also heavy water with Tritium instead which is H with 2 neutrons, but T is radioactive and is dangerous if ingested.

There was supposely a test where they fed mice with all the D2O they can drink and a few days later, the mice died of thrist. They also say, D2O might shorten life and something like 0.005% of water we drink contains D2O

[Edited on 15-7-2003 by MrZ]

We've already got 70 year olds on the road driving twenty under the limit with their blinker on... I don't think I'd like to have a 250 year old going 5kph in a 100kph zone.... cuz you KNOW that's what would happen.