Ebola Virus - Structure

originally posted by: Biotech2024
a reply to: wishes

most of what you mentioned is about trying to increase host defenses/immune system. There may be a basis to it. Like any genetic code through evolution, viruses evolved means to persist over time. The genes they carry trigger immunosuppression and also aid in creating a dispersal syndrome in the host. The methods I'm looking at are more directed towards a specific structural aspects of the virus.

Thank you kindly for making the effort and taking the time to look into these and reply. Most of the population will not have the means to get any treatment and I was thinking/hoping these home remedies might help the survival rate for some should it get so bad.

If you were away from medical/lab options and someone in your family came down with Ebola, is there anything you would try to help?

originally posted by: wishes

originally posted by: Biotech2024
a reply to: wishes

most of what you mentioned is about trying to increase host defenses/immune system. There may be a basis to it. Like any genetic code through evolution, viruses evolved means to persist over time. The genes they carry trigger immunosuppression and also aid in creating a dispersal syndrome in the host. The methods I'm looking at are more directed towards a specific structural aspects of the virus.

Thank you kindly for making the effort and taking the time to look into these and reply. Most of the population will not have the means to get any treatment and I was thinking/hoping these home remedies might help the survival rate for some should it get so bad.

If you were away from medical/lab options and someone in your family came down with Ebola, is there anything you would try to help?

Ebola disease dehydrates very quickly, so rehydration is key since fluid is lost to;

1) elevated temperature
2) vomiting and diarrhea

It's almost impossible to keep up with the loss in fluid even with a IV in place.

Also natural antivirals a are important. If any consumable food has nucleoside analogs than it could fight the virus.

Key is induce lethal mutation every time the virus tries to duplicate itself. Viral titers would be kept low buy time for body to generate specific antibody to fight virus.

a reply to: Biotech2024

There are many foods believed to have antiviral properties, eg garlic, olive leaf extract, echinacea, etc. I have never heard the term 'nucleoside analogs' before and have no idea what foods these might be present in. I did an internet search for foods with nucleoside analogs and it came back with things like cytidine, purine?

Science is like math to me - I have an absolute fascination and interest in them but little ability to understand it in all its complexities. You must have a fabulous mind :-)

One article about cytidine suggested foods like brewer's yeast...

a reply to: wishes

The world is made up of atoms, atoms are made up much smaller particles. Groups of atoms bind together forming molecules. Ebola's genome is made up of adenine (A), cytosine (C), guanine (G), or uracil (U). Adenine and guanine are purines, cytosine and uracil are pyrimidines. So the genome is 19,000 of the above 4 attached together in a long string like pattern.


AGCGUACGUACCCUAAAAAA = 20 nucleotides attached together.

A nucleotide uses a sugar molecule as a backbone, and a combination of nucleotide and sugar molecule(ribose) = nucleoside.

So imagine 19,000 strung together. In order for Ebola to replicate it uses a enzyme called RNA polymerase to create a complementary image of itself. A binds to U, and C binds to G.

AGCGUACGUACCCUAAAAAA
UCGCAUGCAUGGGAUUUUUU = complementary strand

So antivirals in the nucleoside analog group do is they mimic one of the 4 nucleotides. They JAM the RNA polymerase enzyme from making a complementary strand of RNA. Its almost like a key fitting into the keyhole but not able to turn to unlock.

originally posted by: wishes
a reply to: Biotech2024

There are many foods believed to have antiviral properties, eg garlic, olive leaf extract, echinacea, etc. I have never heard the term 'nucleoside analogs' before and have no idea what foods these might be present in. I did an internet search for foods with nucleoside analogs and it came back with things like cytidine, purine?

Science is like math to me - I have an absolute fascination and interest in them but little ability to understand it in all its complexities. You must have a fabulous mind :-)

One article about cytidine suggested foods like brewer's yeast...

you a need very specific molecule to block that RNA polymerase enzyme. Through computer simulations (super computers), drugs can be made that look similar to the 4 nucleotides. Some will have the capacity to disable the viral RNA polymerase without effecting human RNA polymerase or doing damage to human genetic processes.

Some foods may contain nucleoside analogs, but they may be carcinogenic or teratogenic, the food needs to contain a very specific molecule that doesn't damage human cells and only effects viruses.