It looks like you're using an Ad Blocker.

Please white-list or disable AboveTopSecret.com in your ad-blocking tool.

Thank you.

 

Some features of ATS will be disabled while you continue to use an ad-blocker.

 

The Trials HD Riddle: A Look At Gaming’s Da Vinci Code

page: 1
8
<<   2 >>

log in

join
share:

posted on Jul, 6 2011 @ 08:08 AM
link   
My first topic!

I'm hoping this gathers up a bunch of the keenest code-cracking puzzle solving brilliance available on ATS.
First, a little back story.

About 2 years ago a game came out by a company called Redlynx, the game in question is Trials HD. (Its a great game btw on xbox). But, this thread has little to do with the game, but what was HIDDEN inside the game.

This is Easter Eggs on a whole other level. Hidden in the game is a tonne of clues, and to put them all here is beyond me, but head to the below link to get an overview.

As far as is known, all of the hidden clues in game have been found, and most of them have been solved to some degree. But what has still not been solved in the 2 years is the entire meaning of the whole thing. All the clues combine into one question, and answer.

If you think you have the skills to solve a massive conspiracy which will take you from mammoths to Fibonacci, to Orion, da Vinci and beyond, take a gander at this link to see the found clues, pop on a tin foil hat, and any help would be fantastic!

www.kotaku.com.au...

Check out the comments below the article, as you will see the 'boxes' riddle has been tracked down to Stanley Kubrick, apparently he was a box enthusiast! Who knew!

Also, you might find the dedicated thread here www.redlynxgame.com... its a fascinating read, and an amazing hunt to find the ultimate answer!

This will do your head in! :-D



posted on Jul, 6 2011 @ 11:35 AM
link   

Originally posted by Qumulys

Hidden in the game is a tonne of clues, and to put them all here is beyond me, but head to the below link to get an overview.
Maybe you should try.

What you want, is to entice others to dig into this, in order to find the true meaning. What you have provided, may be enough for some, but it may not be intriguing enough to arouse the interest of most. If you can make this more intriguing, you may receive a much larger amount of positive responses.

This↑↑, statement of yours, actually does the exact opposite. It makes it seem as if you are really not as interested in this, as you claim to be. If you don't appear overly enthused about it, then chances are that others won't be either.



Originally posted by Qumulys

an amazing hunt to find the ultimate answer!

Sometimes, the hunt can be very exciting. There still needs to be a good pay-out in the end, otherwise the amazing hunt, will be overshadowed by disappointment, if it turns out that the reward has been highly overemphasized.


"Ovaltine?!?!"
"A crumby commercial!?!"


[color=AFC7C7]Constructive Criticism: Accept it, and try it; or Ignore it.
Just try not to take it the wrong way.



posted on Jul, 6 2011 @ 02:00 PM
link   
Well looking at the link to the Kotaku page, it seems like we have:

* The Fibonacci pattern/Golden Ratio

* Hunter (represented by the cave painting and by Orion)

* Binary (10101001111)

* Hydrogen

* Croatoan

* Darwin's Tree of Life sketch

* Tannen's Magic Mystery Box

* Another box with "SU-122" written yet crossed out and "SKA-788" written underneath that held pictures of the steet where the Jack the Ripper murders took place

* Binary version of the co-ordinates for the Tunguska Event

* Supposed DNA representation

Quoted from the site:


The letters are thought to read CCGGCCAGCGGCCGGGCTCCCCAGCCACGCCCCTGCACCT however the image is difficult to read in parts. There are 40 letters in total.


* Map with a missing piece and links to the Piri Reis Map potentially

* A mammoth


ETA - The guy who came up with the riddle mentions he told the PR Director in case a meteor hit him and the riddle was lost forever with no one knowing the answer then goes on to talk about meteors hitting.

Quote:


How hard has it been to keep this secret to yourself for so long? Does anyone else know the answer?

Not hard. Most people don’t even know that it’s there. Some know it’s there, but they know I won’t say anything. Our P.R. director knows the answer – I told him because if a meteor hit me, the answer would be lost forever!

That might sound like a strange fear, but meteors come close to Earth all of the time. I have instructed my IT guys to set up a screen in the office that constantly monitors all meteors and near-Earth objects at all time, using the data from this NASA website.

Finland is known as the land of 100,000 lakes, and I fear that another will be created by falling meteor. If it should land on me, they can call it Lake Antti.


The website he mentions when clicking the pink word in the web page ("this") comes up with this website:

neo.jpl.nasa.gov...



ETA Part 2 - Having to make another edit because a few things struck me.

I read the comments on the linked website to Kotaku in the OP and I think it seems established that the SKA could be the Stanley Kubrick Archives although somebody else mentioned something about a satellite array in Australia too before the Kubrick connection was stated as the true meaning behind that clue (is it really? who knows)

My thinking on this - however crazy it may sound - is this:

Meteors brought about life on Earth. Evolution and the mutations in the DNA sequences helped create what we are today as homosapiens. The mammoth could relate to the extinction of various creatures over time that once roamed the planet with meteors playing a part in the extinction events such as the dinosaurs.

There seems to be a lot to do with meteors in the developer's Q&A near the bottom of the article.

Hydrogen......a part of our natural atmosphere but more dominant on other planets where oxygen isn't the dominant gas. I have no idea where else that could lead but putting it with the meteor clue, space perhaps? Put that along with Orion?

Speaking of Orion, the hunter taken from a cave painting could mean that since humans existed, we've hunted species for our own food but that we will become the hunted? The least dominant species? Another meteor event in future causing the roles to be reversed?

The Da Vinci sketch of the wings for his flying machine and the plate that Voyager sent into space in 1977 could relate to our desire to push the boundaries and leave the earth. The ancients wanted to fly, now we can fly we want to go further out there beyond the sky and into space.

This is where I'm at a loss and obviously just putting things together how I see it making sense but probably not making any to any of you guys and girls.

It's all related though and part of me thinks that perhaps the developer's constant watch of that NASA website and seeming obsession with meteors could involve something like a meteor impact that wipes out some of our species while survivors have to learn to hunt like our ancestors and evolve and adapt in a world where there may be more hydrogen than currently.

I dunno, any other ideas?


edit on 6/7/2011 by curious7 because: (no reason given)

edit on 6/7/2011 by curious7 because: (no reason given)



posted on Jul, 6 2011 @ 03:16 PM
link   
reply to post by Qumulys
 


awesome thread by the way. I love this kind of stuff. I'll take a look at it in more depth later but possibly he could be hinting at what most of us on ATS already know.

some event to occur in sep-oct ( still a possibility ) .....


To us ...if we found the answer it may be an " ehh thats it , I already suspected that "....

but to those who have no idea what ATS is, this may be " their warning " so to speak...

Any of the clues point to dates .....

Could the DNA sequence be a date of some sorts actually ?



posted on Jul, 6 2011 @ 09:40 PM
link   
reply to post by BrokenCircles
 


Thanks for the input, I do indeed see where your coming from! But the "Riddle" really needs to be taken as a whole otherwise connections may/will be missed. So, I didn't want to just quote massive entire "chunks" of the page. I also know the guy (FatShady) who is working hard on this riddle and wrote the article, so as respect to him, I wanted it to be enjoyed as a whole if possible. But I do thank you for the input! :-D



posted on Jul, 6 2011 @ 09:49 PM
link   
reply to post by curious7
 


Thankyou for trying to get your head around this riddle! (one that does indeed have an answer, a solvable 2 year old riddle which still remains unsolved, I thought was right up ATS's alley!)

I can definitely now confirm that the boxes have been solved!

The su-122 scribbled out was (most likely) not involved. But it turns out that SKA-788 is a naming convention by Stanley Kubrick! He was apparently a massive enthusiast about properly documenting and archiving material he was working on. And this was in fact made into a documentary called "Stanley Kubricks Boxes" at the very last scene in the doco FatShady spotted THE box, it was a massive box with SKA-788 written on it.

Also, it turns out, Stanley Kubrick hired a photographer to photograph the street in question to create a panorama of it! So, The link to Jack the Ripper is most likely a dead end.



I also shared thoughts about Elenin, but, I'm not 100% with that yet.

The binary code was solved a couple of days ago too! It had a zero on the end, which led the guys to the number 2.718 which is the math function "e"

How they all link together into an elegant question and answer is a mystery though still! Someone mentioned maybe the clues are all in pairs, Kubrick/JJ Abrams, Tunguska/space probe etc.

Someone who knows DNA could be really helpful!



posted on Jul, 6 2011 @ 10:19 PM
link   
Just tossing this idea out here, but I wonder if all of these clues were taken from 1 documentary, or even a book? Something like Progress of Mankind or similar?

Also, had a chat with the author, and he is ok with putting all of the puzzles and pics up here. But I need some help in how to quote all of the details with the pics as well. Do I have to upload all those pics to my ATS account first? Or will they work if quoted from the page? (any assistance in this would be awesome!! thanks in advance!)

ATS can solve this one, I'm sure!



posted on Jul, 7 2011 @ 03:54 PM
link   
I always love a good puzzle like this!


[atsimg]http://files.abovetopsecret.com/images/member/055a0693a96f.png[/atsimg]
Besides being the name of a manuscript (authored by Luca Paciol and illustrated by Da Vinci), DE DIVINA PROPORTIONE, or the divine proportion, was the common term in the 15th and 16th centuries for what we today call the golden ratio. The picture on the sign is simply a depiction of the ratio. Note the location of the dot by the number '4'.
[atsimg]http://files.abovetopsecret.com/images/member/77a505528539.gif[/atsimg]
I have no idea why the '4' is there, though.

The golden ratio is also represented by the two golden rectangles, as is the Fibonacci series. Both are based on and closely related to Phi.
[atsimg]http://files.abovetopsecret.com/images/member/9ce4e84ee4f6.png[/atsimg]

The second golden rectangle has a sequence of dots and spaces underneath it, representing 1's and 0's (binary).
[atsimg]http://files.abovetopsecret.com/images/member/75d8b940f5bd.png[/atsimg]
In binary, it reads 101010011110. In decimal this is 2718, the first four digits of 'e' (2.718).


I haven't found any pictures yet, but this was posted today on the Red Lynx board:

Escaping ramps does have a 14 lit up under the track about halfway through...also a 3 near the start

So besides Phi and e, we now have pi. Three irrational numbers that continue to infinity and keep reappearing in life, the universe, and everything

[atsimg]http://files.abovetopsecret.com/images/member/59ce02c93366.png[/atsimg]
Or maybe not...

edit on 7/7/2011 by AdmireTheDistance because: (no reason given)



posted on Jul, 7 2011 @ 04:05 PM
link   
Also interesting (but probably not relevant):

-The number e is also called Euler's number, after Leonhard Euler.
-The Fibonacci series is named after Leonardo Fibonacci.
-Multiple clues point to Leonardo da Vinci.

That's quite a few Leonards for one riddle!



posted on Jul, 7 2011 @ 04:08 PM
link   
Trials HD is a fantastic game, absolutely addictive.

Don't play it, you will be chasing friends high scores forever!



posted on Jul, 7 2011 @ 07:32 PM
link   
reply to post by yakuzakid
 


Don't tell me how addictive it is, its ruined my life! (In a totally cool way!)



posted on Jul, 7 2011 @ 08:03 PM
link   
reply to post by AdmireTheDistance
 


There is some really great ideas there! Thanks heaps mate! :-D The forum guys over at Redlynx have already used some of your ideas! This riddle is getting closer to being solved.

I honestly HATE having to say this, because it annoys me no end when people do say this, but we really could do with the researching skills/brain of Phage (I love his skills, and here is something which is not silly fairy-tale ufo debunking, there's an actual question and answer to be unearthed here. Also, if any of you guys on here know of other top quality researchers like Phage, is there a way to prod them into some beard scratching (or head scratching with the ladies! (or, even beard scratching with some of those rather older ladies... :-P ))

I'm beginning to think it may be related to Carl Sagan's Cosmos.... ?



posted on Jul, 8 2011 @ 02:33 AM
link   
reply to post by AdmireTheDistance
 


You've got me thinking about the "Leo" thingy. There's the three Leo's you mentioned, I wondered if the Leonid Meteor showers had anything to do with it.
Upon searching, I found a guy called "Leonid Alekseyevich Kulik" who researched the Tunguska event!

Leo Leo Leo Leo!



posted on Jul, 8 2011 @ 04:47 AM
link   

Originally posted by Qumulys
reply to post by AdmireTheDistance
 


You've got me thinking about the "Leo" thingy. There's the three Leo's you mentioned, I wondered if the Leonid Meteor showers had anything to do with it.
Upon searching, I found a guy called "Leonid Alekseyevich Kulik" who researched the Tunguska event!

Leo Leo Leo Leo!


I can't recall but is there anything related to the meteors and the NASA website related to August perchance? Considering the star sign for that month is Leo.



posted on Jul, 8 2011 @ 05:44 AM
link   
 




 



posted on Jul, 8 2011 @ 05:55 AM
link   
reply to post by andersion
 


Yeah.... Thanks Spammy McSpammerson, but that is not helping! :-/



posted on Jul, 8 2011 @ 06:00 AM
link   
reply to post by curious7
 


I was thinking the star sign Leo too, but thats an interesting thought about Nasa. We need some of those elenin crowds to get involved, the ones who know their way around the Nasa web pages.

I'm going down a track of books. There was many many instances in "Cosmos" by Carl Sagan, and I'm now reading a book "The Grand Design" by Stephen Hawking and (wait for it) Leonard Mlodinow! It stars of well, with spirals and then quotes Hitch Hikers 42. But then kind of goes off track. Well, thats where I'm researching at the moment. I sure as heck am learning heaps of cool things though, this is one of the coolest riddles ever!



posted on Jul, 8 2011 @ 06:23 AM
link   
reply to post by Qumulys
 


I'm sure it was mentioned somewhere on ATS that we'd first be able to see the Elenin comet near our orbit in August and that it will be visible to the naked eye in September or October so could be something there.



posted on Jul, 8 2011 @ 12:45 PM
link   
reply to post by curious7
 


This game came out in 2009 and comet Elenin wasn't discovered until December, 2010, so I'm pretty sure it's not relevant to this puzzle...



posted on Jul, 8 2011 @ 05:34 PM
link   
reply to post by AdmireTheDistance
 


I'll second that, the Elenin stuff is too "lofty" for this puzzle. So far the way everything thats been found and linked is very elegant. But what might help is the elenin debunker crowds, who know their way around real comet/meteor facts, due to some relationship to space and Tunguska.



new topics

top topics



 
8
<<   2 >>

log in

join